Journal of Global Infectious Diseases

MICROBIOLOGY REPORT
Year
: 2017  |  Volume : 9  |  Issue : 2  |  Page : 73--75

Susceptibility pattern of enterococci at tertiary care hospital


Sadhana Sachan, Vinita Rawat, Umesh, Mukesh Kumar, Tripta Kaur, Preeti Chaturvedi 
 Department of Microbiology, Government Medical College, Haldwani (Nainital), Uttarakhand, India

Correspondence Address:
Vinita Rawat
Department of Microbiology, Government Medical College, Haldwani (Nainital), Uttarakhand
India

Abstract

The study was aimed to characterize enterococci from various clinical specimens, to determine the antimicrobial susceptibility pattern, and to explore the association between virulence factors and antimicrobial resistance. A total of 283 clinical enterococcal isolates were speciated and subjected to antimicrobial susceptibility testing. Virulence factors (hemolysin, gelatinase, and biofilm production) were detected phenotypically. Of the 283 enterococci isolated, 12 species were identified; predominant species were Enterococcus faecalis (82.33%). High-level gentamicin (HLG) and vancomycin resistance were observed among 55.57% and 6.01% of enteroccal isolates, respectively. All vancomycin-resistant enterococci (VREs) were E. faecalis and had VanA phenotype and genotype. Hemolysin, gelatinase, and biofilm production were seen in 15.90%, 12.36%, and 13.43% of enterococcal isolates, respectively. Vancomycin and HLG resistance were observed in 0.35% and 61.86% of the enterococcal isolates producing virulence factors. Isolates resistant to HLG but susceptible to vancomycin expressed more virulent factors. Further research is required to reveal the complex interplay between drug resistance and virulence factors.



How to cite this article:
Sachan S, Rawat V, Umesh, Kumar M, Kaur T, Chaturvedi P. Susceptibility pattern of enterococci at tertiary care hospital.J Global Infect Dis 2017;9:73-75


How to cite this URL:
Sachan S, Rawat V, Umesh, Kumar M, Kaur T, Chaturvedi P. Susceptibility pattern of enterococci at tertiary care hospital. J Global Infect Dis [serial online] 2017 [cited 2021 Mar 1 ];9:73-75
Available from: https://www.jgid.org/text.asp?2017/9/2/73/194371


Full Text

 Introduction



Enterococci have emerged as an increasingly important cause of nosocomial infections in the last decade.[1] Enterococci from clinical sources show an alarming increase with properties of intrinsic resistance to several antibiotics.[2] Until recently, vancomycin was virtually the only drug that could be consistently relied on for the treatment of infections caused by multidrug-resistant enterococci.[3] However, emergence of vancomycin-resistant enterococci (VREs) and their increasing prevalence worldwide has made it difficult to treat serious enterococcal infections.[2] Few species such as Enterococcus gallinarum and Enterococcus casseliflavus are intrinsically resistant to vancomycin,[2] so it becomes essential to identify these species to avoid inappropriate treatment with vancomycin. Along with the emergence of multidrug resistance, the presence of several virulence factors in enterococci is an emerging concept. However, there are limited Indian studies elucidating the relationship between antimicrobial resistance and virulence factors among enterococcal isolates.

Hence, the present study was designed to investigate the profile of enterococcus species, their antimicrobial resistance pattern, associated virulence factors, and the relationship between antimicrobial resistance and virulence factors among enterococcal isolates, which is quintessential for management and prevention of these bacteria in any healthcare facility.

 Microbiology Report



A total of 283 consecutive enterococcal isolates received from various clinical samples (blood, pus, urine and body fluid) over a period of 2 years from November 2013 to October 2015 were identified and speciated according to standard laboratory procedure as per the scheme of Facklam and Collins.[4] The clearance from the institutional ethics committee was obtained to carry out this study. The sources and the species of enterococcal isolates are summarized in [Table 1]. Four species could not be identified due to aberrant sugar reactions by conventional method.{Table 1}

For studying the antimicrobial susceptibility pattern in enterococcal isolates, four methods were used (a) Kirby–Bauer disc diffusion technique,[5] (b) vancomycin screening agar method,[5] (c) minimum inhibitory concentration (MIC) testing by E strips, and (d) agar dilution method [5] for vancomycin.

For disc diffusion testing, ampicillin (10 μg), high-level gentamicin (HLG) (120 μg), erythromycin (15 μg), vancomycin (30 μg), teicoplanin (30 μg), and linezolid (15 μg) discs were used. For urine isolates, additional discs of levofloxacin (5 μg), norfloxacin (10 μg), and nitrofurantoin (300 μg) were used. Antimicrobial resistance pattern of enteroccal isolate from various clinical specimens is depicted in [Table 2]. On the basis of MIC of vancomycin (>64 μg/ml) and teicoplanin (>16 μg/ml), all vancomycin-resistant isolates were categorized as Van A phenotype. A total of 17 VREs were detected phenotypically as VanA.{Table 2}

Polymerase chain reaction (PCR) was performed for detection of VanA gene among VRE isolates. Briefly, the 25 μl of PCR contained 2–4 well-isolated colonies, 2.5 μl, ×10 PCR buffer, 2 μl, 25 Mm MgCl2, 1 μl, 10 Mm dNTPs, 1 μl, 10 pm forward primer (5'GCGATATTCAAAGCTCAGCAA3') 1 μl, 10 pm reverse primer (5'TGCCGATTCAATTGCGTAGTC3'), 0.5 μl Taq DNA, and 17 μl nuclease-free water. Reaction was performed in thermocycler, and initial denaturation was done at 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 51.70°C for 1 min, extension at 72°C for 1 min, and final extension done at 72°C for 7 min. Amplified PCR products were detected by 1.5% agarose gel electrophoresis.

All 17 VREs were detected phenotypically as VanA and were further confirmed by PCR as VanA genotype. One PCR product was sequenced. The GenBank accession number assigned to our sequence is KU 667286.

Virulence factors (hemolysin, gelatinase, and biofilm production) were detected phenotypically. Hemolysin production was detected in 5% blood agar.[6] Gelatinase activity was detected in 4% gelatin agar and clearing seen by mercuric chloride solution.[6] Biofilm formation was detected by tube method.[7] Among virulence factors tested, hemolysin was produced by 15.90%, biofilm by 13.43%, and gelatinase by 12.36% of the 283 enterococcal isolates. Relationships between enterococcal virulence and antimicrobial resistance are depicted in [Table 3].{Table 3}

We observed that isolates resistant to HLG but susceptible to vancomycin expressed more virulence factors than vancomycin-resistant ones. This is in congruence with other studies from India.[8],[9] The drug-resistant determinants in enterococcal and virulence genes are plasmid-borne with immense ability for genetic exchange both intragenically and intergenically.[10] It has been speculated that increase in one aspect of survival fitness reduces the other. Consequently acquisition of one set of plasmid may lead to loss of the other either due to incompatibility or due to fitness cost benefits.

 Conclusion



Our study reveals the occurrence of a sizable number of HLG-resistant isolates and emergence of VRE. Linezolid demonstrated good antienterococcal activity and may be kept as the drug of choice for VRE isolates in our set up. Isolates resistant to HLG but susceptible to vancomycin expressed more virulence factors. Further research is required to reveal the complex interplay between drug resistance and virulence factors.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1Fernandes SC, Dhanashree B. Drug resistance & virulence determinants in clinical isolates of Enterococcus species. Indian J Med Res 2013;137:981-5.
2Prakash VP, Rao SR, Parija SC. Emergence of unusual species of enterococci causing infections, South India. BMC Infect Dis 2005;5:14.
3Cetinkaya Y, Falk P, Mayhall CG. Vancomycin-resistant enterococci. Clin Microbiol Rev 2000;13:686-707.
4Facklam RR, Collins MD. Identification of Enterococcus species isolated from human infections by a conventional test scheme. J Clin Microbiol 1989;27:731-4.
5CLSI. Performance Standard for Antimicrobial Susceptibility Testing Twenty-second Informational Supplement. CLSI Document M100-S22. PA: Clinical and Laboratory Standard Institute; 2012. p. 92-4.
6Giridhara Upadhyaya PM, Umapathy BL, Ravikumar KL. Comparative study for the presence of enterococcal virulence factors gelatinase, hemolysin and biofilm among clinical and commensal isolates of Enterococcus faecalis. J Lab Physicians 2010;2:100-4.
7Mathur T, Singhal S, Khan S, Upadhyay DJ, Fatma T, Rattan A. Detection of biofilm formation among the clinical isolates of staphylococci: An evaluation of three different screening methods. Indian J Med Microbiol 2006;24:25-9.
8Teixeira L, Carvalho M, Facklam R. Enterococcus. In: Murray P, Baron E, Jorgensen J, Landry M, Pfaller M, editors. Manual of Clinical Microbiology. 9th ed. Washington: ASM Press; 2007. p. 434-5.
9Tomita H, Pierson C, Lim SK, Clewell DB, Ike Y. Possible connection between a widely disseminated conjugative gentamicin resistance (pMG1-like) plasmid and the emergence of vancomycin resistance in Enterococcus faecium. J Clin Microbiol 2002;40:3326-33.
10Banerjee T, Anupurba S. Prevalence of virulence factors and drug resistance in clinical isolates of enterococci: A study from North India. J Pathog 2015;2015:692612.